Sunday, February 28, 2010

Hpv Infection In Men


Much of the information about HPV virus centers on women, since having the virus increases their risk of getting cervical cancer. But HPV virus in men can cause health problems, too. It's important for men to understand how to reduce the risks of HPV infection. HPV infection can increase a man's risk of getting genital cancers, although these cancers are not common. HPV can also cause genital warts in men, just as in women.

More than half of men who are sexually active in the United States will have HPV at some time in their life. Often, a man with no health problems will clear the virus on his own. The types of high-risk HPV that can cause cancer rarely present any symptoms in men or in women. Genital warts are the first symptom you may see with low-risk HPV strains that cause warts but not cancer.

Abstinence is the only sure way to prevent HPV transmission. Risk of transmission can be lowered if a person has sex only with one person who is not infected and who is also monogamous. To lower the risk of HPV transmission, men can also limit the number of sex partners and pick partners who have had few or no partners in the past. Condoms can provide some protection against HPV transmission.

Unfortunately, they aren't 100% effective, since HPV is transmitted primarily by skin-to-skin contact. The virus can still infect the skin uncovered by the condom. In a recent study of young women who had just become sexually active, those whose partners used a condom each time they had sex were less likely to get an HPV infection than were women whose partners used a condom less than 5% of the time.

How to test for HPV infection in men? To diagnose genital warts in men, the doctor will visually check a man's genital area to see if warts are present. Some doctors will apply a vinegar solution to help identify warts that aren't raised and visible. But the test is not foolproof. Sometimes normal skin is mistakenly identified as a wart.

There is no routine test for men to check for high-risk HPV strains that can cause cancer. However, some doctors are urging anal Pap tests for gay and bisexual men, who are at higher risk of anal cancer caused by HPV. In an anal Pap test, the doctor collects cells from the anus, and then has them checked for abnormalities in a lab.

There is no treatment for HPV infection in men when no symptoms are present. Instead, doctors treat the health problems that are caused by the HPV virus. When genital warts appear, a variety of treatments can be used. The patient can apply prescription creams at home. Or a doctor can surgically remove or freeze off the warts.

Early treatment of warts is discouraged by some doctors because genital warts can go away on their own. It can also take time for all warts to appear. So a person who treats warts as soon as they appear may need another treatment later on. Anal cancer can be treated with radiation, chemotherapy, and surgery. The specific treatments depend on the stage of cancer.

HPVCurative is a new, highly effective and potent way to cure genital warts. It is valued for its role in the realm of genital warts cures, and has provided total clearance of the infection time after time. It contains certified organic medicinal plant extracts and antiviral essential oils, which have demonstrated the ability to act as an HPV cure in laboratory tests.

HPVCurative contains certified organic antiviral extracts, which have the demonstrated ability not only to act as HPV cures, but also to stimulate CD4 T-cells, which cleanse virus-infected cells. HPVCurative thereby eradicates genital warts without any recurrence, making it superior to other genital warts cures.

The low molecular weight and lipophilic tendency of the HPV cure enables it to penetrate into the DNA of infected cell membranes, where the HPV virus resides. HPVCurative is so effective among available HPV cures because it not only contains only the most potent certified organic antiviral medicinal plant extracts, but is highly tolerable to genital tissue as well.

CURED use plant extracts for their genital warts cures that are produced in very limited quantities, and are not available in the commercial market due to scarcity. These medicinal plant extracts are purchased directly by CURED from cultivators in Sri Lanka and Madagascar. To learn more, please go to http://www.bcured.net.

bcured - About the Author:
staff of Nature Power Company, which is a network company dedicated to promoting customers\' websites and developing softwares. You can go to the following websites to learn more about our natural organic products. http://www.bcured.net  http://www.naturespharma.org


Saturday, February 27, 2010

High-Risk Hpv Infection


Certain HPV types are classified as "high-risk" because they lead to abnormal cell changes and can cause genital cancers: cervical cancer as well as cancer of the vulva, anus, and penis. In fact, researchers say that virtually all cervical cancers (more than 99%) are caused by these high-risk HPV viruses.

The most common of the high-risk strains of HPV are types 16 and 18, which cause about 70% of all cervical cancers. If the body clears the infection, the cervical cells return to normal. But if the body doesn't clear the infection, the cells in the cervix can continue to change abnormally. This can lead to precancerous changes or cervical cancer.
When infection with high-risk HPV types occurs, there usually are no symptoms. Often, the first clue is a Pap test result that is abnormal. In a Pap test, the doctor takes a swab of cervical cells and has them analyzed in a laboratory. A positive HPV test may not mean a woman needs treatment, at least not immediately.

Having a positive test puts a woman in the "high-risk" class, alerting the doctor that she is at higher risk for cervical tissue changes and may need close evaluation. If the Pap test results are unclear, the doctor may order a HPV test to check the DNA type of the virus. This analysis can identify 13 of the high-risk HPV types associated with cervical cancer.
It does not identify cancer. But it tells the woman and her doctor if she has a type of HPV capable of causing cancer. Researchers have discovered that high-risk HPV viruses produce certain proteins. These proteins interfere with the cell functions that limit excessive cell growth. If abnormal cervical tissue changes progress, treatment of the HPV infection may be needed.

There's only one sure way to eliminate chance of HPV infection: Avoid all genital contact with another person. It's best to have a mutually monogamous sexual relationship with an uninfected partner. But many people don't know if they're infected. Using condoms can help prevent HPV transmission but are not foolproof. The virus can be transmitted to genital areas not covered by the condom.

A vaccine, Gardasil, was approved for use in 2006 for use in girls and women aged 9 to 26. Eventually, it may be approved for use in boys, too. Another vaccine, Cervarix, was approved by the FDA in 2007. Over time, widespread vaccination will help prevent transmission of the HPV types covered by the vaccines.

The Gardasil HPV vaccine protects against several high-risk strains of HPV, including HPV types 16 and 18, which account for 70% of cervical cancers. It also protects against HPV 6 and 11, which account for about 90% of genital warts. Cervarix protects against HPV types 16, 81, 31, and 45 -- all of which can cause cervical cancer.

Among the HPV treatment options are surgery, laser treatment, and freezing. Pregnant women, or women considering pregnancy, should consult closely with their doctor. The risk of passing HPV on to the baby is very low. But HPV treatments can affect pregnancy, so doctors may want to delay treatment until after childbirth.

Most doctors use cauterization or freezing as a first option to cure genital warts. Unfortunately, success achieved with this method is often temporary and the warts soon reappear. For genital warts, cures may involve having to surgically excise or burn them off. After surgical intervention or chemical acids are used, one can expect a scar in that area.

An alternative antiviral treatment is now available which represents a very promising solution to the growing epidemic of genital warts. HPVCurative is a new, highly effective and potent way to cure genital warts. It is valued for its role in the realm of genital warts cures, and has provided total clearance of the infection time after time.

It contains certified organic medicinal plant extracts and antiviral essential oils. Users of HPVCurative experience rapid elimination of genital warts without scarring or recurrence. The treatment is painless and provides superb results when compare to other HPV cures. It eliminates genital warts and restores skin tissue to the state it was in prior to the infection.

Organic extracts that demonstrated the greatest antiviral effect as HPV cures in comprehensive scientific trials, while having the least side effects on genital tissue, have been blended to create HPVCurative. To learn more, please go to http://www.bcured.net.

bcured - About the Author:
staff of Nature Power Company, which is a network company dedicated to promoting customers\' websites and developing softwares. You can go to the following websites to learn more about our natural organic products. http://www.bcured.net  http://www.naturespharma.org


Friday, February 26, 2010

HPV Testing for Women

Women, get a pap smear and an HPV test at your next opportunity. Do not put it off or deem it unnecessary.

Sorry if we seem a bit militant on this front. All men have to worry about when it comes to HPV is the problem of dealing with an ugly infection. In women, HPV can be fatal.

It is estimated that cervical cancer affects 473,000 women every year, killing 253,500 women. Most of these cases are directly linked with genital HPV.

To put that in perspective, breast cancer kills about 519,000 women a year. Breast cancer gets a lot of media attention because of its high casualty rate, but efforts against HPV and cervical cancer have not enjoyed the same amount of attention, and this has led many women to neglect regular testing.

The major problem here tends to be the misconception that HPV means genital warts
. Several strains of HPV can lead to genital warts, but the types that can lead to cervical cancer do not show any visible symptoms whatsoever, and can only be effectively identified by a pap smear.

In that few men have ever died of HPV related conditions, men can more easily get away with saying “I trust my partner, I’m safe”, but this is not an option for women. Remember that when you have sex with a new partner, you are having sex with everyone they have ever had sex with. Your boyfriend or husband may have been tested negative for HPV, but, again, the types of HPV that can lead to cervical cancer show absolutely no visible signs, and would be nearly impossible to detect in men.

Apologies for the “preachy” tone being employed here, but the fact remains that there are no safe bets when you’re betting with your life. You cannot be one hundred percent certain that you’re free and clear until you’ve been tested.

Are pap smears inconvenient, uncomfortable, and embarrassing? Of course they are, but they save lives.

As for the visible HPV types, the types which result in genital warts, here are the steps to take when considering being tested…

1- Self inspection

When you have a chance, during a shower, before bed, whenever you can, check yourself for any abnormal bumps or lesions on or around your genitals. If you see even the slightest thing out of place…

2- Talk to your doctor

It may wind up being nothing, but you won’t know for sure without your gynaecologist or physician’s input. If it does wind up being HPV…

3- Take the appropriate steps

Don’t sleep on it, just get your hands on something from the pharmacy right away. Catching HPV early means you can nip it in the bud, so act fast.

Beyond that, just remember that testing and treating HPV is important, but not as important as preventing HPV. Always practice safe sex, always use latex condoms with a new partner, and check yourself regularly to make sure you’re safe. In short, don’t take any chances with your health or your life.


Michelle Anderson - About the Author:
HPV Health is dedicated to bringing you the most current information on HPV. We are dedicated to helping you. For more information on symptoms and treatments visit HPV Treatment.

Thursday, February 25, 2010

Hpv And Cervical Cancer


Nearly two decades ago, experts discovered a relationship between infection with HPV and cervical cancer. Since then, these experts have learned much more about how HPV can lead to cervical cancer. The following are some knowledge every woman and girl should know about HPV and cervical cancer.

There's only one sure way to eliminate any chance of HPV infection: Avoid all genital contact with another person. Actual cervical cancer is rare in the U.S. because most women get Pap tests and have abnormal cells removed before they turn into cancer. Still, lots of women will find out they have cervical cancer every year and some will die of the disease.

There are more than 100 types of HPV. About 30 or so types can cause genital infections. Some types of HPV, typically HPV 6 and HPV 11, cause genital warts. The warts are rarely associated with cervical cancers. They are considered "low-risk" HPV. Other types can cause cervical or other genital cancers.

The other 70 or so HPV types can cause infections and warts elsewhere on the body, such as on the hands. Most sexually active women and men will contract HPV at some point in their lifetime. Most will never even know it. Usually, this virus does not cause any symptoms and doesn't cause disease. Often, the body can clear HPV infection on its own within two years or less.

HPV types associated with genital infections are transmitted sexually, primarily through skin-to-skin contact during sexual activity. HPV can also be spread through oral sex. The chance of getting HPV rises with certain risk factors: number of lifetime sexual partners, young age, and women who are sexually active with men who have other partners at the same time.

To reduce risk, it's best to have a mutually monogamous sexual relationship with an uninfected partner. But keep in mind, many people don't know if they're infected. Using condoms can help prevent HPV transmission but are not foolproof. The virus can be transmitted to genital areas not covered by the condom.

A vaccine, Gardasil, was approved for use in 2006 for use in girls and women aged 9 to 26. Eventually, it may be approved for use in boys, too. Another vaccine, Cervarix, was approved by the FDA in 2007. Over time, widespread vaccination will help prevent transmission of the HPV types covered by the vaccines.

The Gardasil HPV vaccine protects against several high-risk strains of HPV, including HPV types 16 and 18, which account for 70% of cervical cancers. It also protects against HPV 6 and 11, which account for about 90% of genital warts. Cervarix protects against HPV types 16, 81, 31, and 45 -- all of which can cause cervical cancer.

Among the HPV treatment options are surgery, laser treatment, and freezing. Pregnant women, or women considering pregnancy, should consult closely with their doctor. The risk of passing HPV on to the baby is very low. But HPV treatments can affect pregnancy, so doctors may want to delay treatment until after childbirth.

Traditional theories postulated that once a person is infected, HPV remained in the body for a lifetime. However, new studies using sensitive DNA techniques have shown that an HPV cure is possible through immunological response. For example, studies on compounds to cure genital warts demonstrate that HPVCurative extracts created "significant destruction of HPV cells as evidenced from DNA tests".

These studies further concluded that among other genital warts cures, HPVCurative best extracts "inhibited skin papillomas virus and decreased the conversion of papillomas to carcinomas" which resulted in "significant disintegration of HPV cells in DNA tests" without damaging surrounding healthy tissue.

HPVCurative is undiluted and unadulterated. It contains stringently certified organic antiviral plant extracts, which have the ability to destroy HPV. The extracts are harvested and distilled by hand for medicinal use -- they are pure and complete. This is essential when creating HPV cures, and it is of critical importance when applying anything to the genitals.

To cure genital warts, simply apply one drop of product to the affected area three times a day. HPVCurative is offered at a great price compared to competing HPV cures. It treats multiple warts and is also most suitable among other genital warts cures in the market for those afflicted with stubborn strains. To learn more, please go to http://www.bcured.net.

bcured - About the Author:
staff of Nature Power Company, which is a network company dedicated to promoting customers\' websites and developing softwares. You can go to the following websites to learn more about our natural organic products. http://www.bcured.net  http://www.naturespharma.org


Wednesday, February 24, 2010

HPV Testing for Men


One of the first things you need to know about HPV testing for men… is that you need to be tested before you can be certain.

If you have any degree of sexual experience, getting tested is a good idea. You can’t just inspect yourself, trust that you don’t have anything, and forget about it. HPV can remain dormant for years, decades, even a lifetime without showing any symptoms, but can still be contagious. In women, it is the types of HPV that actually have no symptoms that can lead to cervical cancer.

Luckily, most genital HPV types are harmless. In fact, it’s estimated that anywhere from one third to one half of all sexually active adults have contracted a benign form of HPV at one point or other. However, this isn’t the case with all HPV types, so it’s important to get tested.

Should I get Tested?

The first question would probably be… how would you know if you need to be tested?

Well, if you’ve ever had sex before, you should get yourself tested, and get tested again after every encounter with a new sexual partner.

This is sort of a blanket statement. What if you’ve only had one sexual partner in your entire life, and you can verify that your partner only had one partner before you?

Genital HPV is generally only spread through actual sexual intercourse, and not say, toilet seats or what have you, so wouldn’t a clean sexual history make it a safe bet that you don’t have HPV?

No. You’ve no doubt heard that when you have sex with a new partner, you are, in effect, having sex with everyone they’ve ever been with. This is how STDs spread, from one sex partner to another, to another, to another. Unless you have detailed test results from your partner, your partner’s previous partner or partners, and their previous partners, you can’t be one hundred percent sure.

How do they do the Test?

Getting tested for HPV as a man is easy. Women have to undergo the discomfort of a pap smear, so count yourself lucky and just go ahead and go through with it already.

HPV testing in men is done with a simple visual check. Your physician may spot the genital warts on sight, or may use acetic acid to identify warts and HPV related lesions. The acid causes the abnormal tissue to become white.

HPV testing for men can be a little tricky when the infection is in its early stages. You can have HPV and not know it, simply because the test didn’t prove anything. For this reason, you absolutely must practice safe sex. You might think you’re safe, when in fact, you are not. Always use a condom, and see your doctor at the first sign of anything that might, in fact, be the early stages of an HPV infection.

More important than getting tested or treated is simply preventing HPV in the first place. Do not have sex without a condom unless you can be certain that you and your partner are both clear and free, simple as that.
 
Michelle Anderson - About the Author:
HPV Health is dedicated to bringing you the most current information on HPV. We are dedicated to helping you. For more information on symptoms and treatments visit HPV.

Tuesday, February 23, 2010

Information about HPV


HPV stands for human papilloma virus and infection with the HPV virus is common. HPV infects at least 50% of all people who have sex at some time in their lives. Often, people don't have any symptoms and the HPV infection goes away on its own. Some types of HPV can lead to cervical cancer or cancer of the anus or penis.

There are actually more than 100 related viruses in this group and each HPV virus is given a number or type. The term "papilloma" refers to a kind of wart that results from some HPV types. HPV lives in the body's epithelial cells. These are flat and thin cells found on the skin's surface and also on the surface of the vagina, anus, vulva, cervix, penis head, mouth, and throat.

Of the 100 HPV types, about 60 types cause warts on areas such as the hands or feet. The other 40 or so types of HPV are sexually transmitted and are drawn to the body's mucous membranes, such as the moist layers around the anal and genital areas. These sexually-transmitted HPV viruses are spread through contact with infected genital skin, mucous membranes, or bodily fluids.

The sexually-transmitted HPV viruses can be passed through intercourse and oral sex. HPV can infect skin not normally covered by a condom, so using a condom does not fully protect you from the virus. Also, many people don't realize they're infected with HPV and may have no symptoms, so neither sexual partner may realize that the virus is being spread.

Not all of the 40 sexually transmitted HPV viruses cause serious health problems. High-risk HPV strains include HPV 16 and 18, which cause about 70% of cervical cancers. Other high-risk HPV viruses include 31, 35, 39, 45, 51, 52, 58, and a few others. Low-risk HPV strains, such as HPV 6 and 11, cause about 90% of genital warts, which rarely develop into cancer.

Genital warts can look like bumps or growths. Sometimes they are shaped like cauliflower. The warts can show up weeks or months after exposure to an infected sexual partner. You're more likely to get HPV if you have sex at an early age, have many sex partners, or have a sex partner who has had multiple partners.

While many people think HPV is mostly a problem for teens or young adults, HPV can infect men and women of any age. In fact, a 2007 survey found that nearly 27% of U.S. women between the ages of 14 and 59 have HPV, according to a report in the Journal of the American Medical Association.

The only way to absolutely avoid the risk of HPV infection is to abstain from sex. You can also limit the number of sexual partners you have. And you can choose partners who've had few or no sexual partners before you. However, while a long-term monogamous relationship lowers your risk, it's important to remember that many people are infected and never know it.

Often, there are no symptoms of an HPV infection and the body clears the infection on its own over the course of a few years. Some people never know they were infected. About 90% of women infected with HPV show no traces of the virus within two years. When an HPV infection with high-risk types persists, it can cause abnormal changes in the cells of the cervix. Rarely, it may also cause abnormal changes in penile and anal cells.
HPVCurative is a new, highly effective and potent way to cure genital warts. It is valued for its role in the realm of genital warts cures, and has provided total clearance of the infection time after time. It contains certified organic medicinal plant extracts and antiviral essential oils, which have demonstrated the ability to act as an HPV cure in laboratory tests.

Users of HPVCurative experience rapid elimination of genital warts without scarring or recurrence. The treatment is painless and provides superb results when compare to other HPV cures. It eliminates genital warts and restores skin tissue to the state it was in prior to the infection. Since the treatment can effectively remove genital warts and wart-like substances on the genitals, acid or surgical HPV cures may soon become a thing of the past.

HPVCurative contains stringently certified organic antiviral plant extracts, which have the ability to destroy the genital wart virus. The extracts are harvested and distilled by hand for medicinal use. This is essential when creating HPV cures, and it is of critical importance when applying anything to the genitals. To learn more, please go to http://www.bcured.net.

bcured - About the Author:
staff of Nature Power Company, which is a network company dedicated to promoting customers' websites and developing softwares. You can go to the following websites to learn more about our natural organic products. http://www.bcured.net  http://www.naturespharma.org


Monday, February 22, 2010

Hpv Women – Why Protection Is Critical


When you have sex with a new partner, you're having sex with every partner they ever had sex with, and every partner they had sex with, and on and on…

Researchers have uncovered over 35 different types of HPV that infect the genital tract, and of these, at least 15 are known to lead to cervical cancer. The most dangerous strains, #16,  #18, #31 and #45 account for over 70% of all cervical cancers. HPV is also known to cause cancer in the vulva, vagina, anus, head and neck.

What Is HPV?

Genital HPV (human papilloma virus) is the most common sexually transmitted disease and it's believed that up to 70% of women will have come into contact with HPV by the time they're 60 years old.


Most women may never show any signs of HPV infection and their immune system fights off the virus. However, for a number of women, certain strains of HPV can lead to genital warts, which are a clear indication that she has come into contact with a sexual partner who has HPV.

While genital warts can be embarrassing, unsightly and often painful, the strains of HPV that are responsible for this type of infection are different from the strains that can develop into cervical cancer.

HPV causes normal cells to become abnormal. These abnormalities can present in the form of genital warts, which often appear within weeks or months of infection. However, it's the strains of HPV that lead to cervical cancer which you need to be most concerned about. These infections can lay dormant in your system for many years and display no signs or symptoms. But over time, the infection alters cells in the cervix and by the time the cancer is detected in HPV women, it can be too late.

How to Protect Yourself Against HPV

Every year hundreds of thousands of women die from cervical cancer that is directly linked to HPV. The reason so many women die from this form of cancer is because the symptoms often go undetected for many years.

So it's important to do everything you can to protect yourself from the risks associated with HPV. Let's look at some of the steps you can take:

1. A HPV vaccine is available to girls and women between the ages of 9 and 26 which prevents the most common strains of HPV in women. In particular, the vaccine protects women against the strains which can lead to cervical cancer.

This vaccine is most effective on women who have had no previous sexual experiences.

2. The most effective HPV treatment is a regular Pap smear to test for any abnormal cells in the cervix. If you have the same sexual partner, or you are not sexually active, a Pap smear once a year is appropriate. After the age of 30, your medical practitioner may suggest you have a Pap smear every 2 or 3 years.

If you have a number of sexual partners, it doesn't hurt to have a Pap smear every time you start a new relationship. Sure, Pap smears are a little uncomfortable, but a few moments of feeling uncomfortable is worth it if the results show abnormal cell development.

That wonderful new man you've just met may be THE ONE, but he may also unwittingly be THE ONE who is carrying a HPV infection he isn't aware of, and it's easy to pass that virus on to you.

3. Have a frank and open discussion with new sexual partners. Although it may seem embarrassing, it could save your life! If you have ever had an outbreak of genital warts, this type of infection can't be cured so although you may not have any symptoms, you can easily transmit the virus to your partner.

Similarly, he may have been exposed to the virus and not know.

4. Practice safe sex. Although HPV is the most common sexually transmitted disease, it's only one of many, so practicing safe sex by using a condom can help protect you against a number of serious infections.

5. Keep yourself healthy and well. You can reduce the risk of contracting HPV if your immune system is strong enough to fight off the infection. But let's face it: being healthy isn't just about protecting yourself against HPV – it's about protecting yourself from a number of infections that can attack your system if it's not in good shape.

HPV and women can be a deadly combination, so ensure you read all the information you can about the risks and know how to arm and protect yourself at all times.

Michelle Anderson - About the Author:
HPV Health is dedicated to bringing you the most current information on HPV.  We are dedicated to helping you.  For more information on symptoms and treatments visit: http://www.hpvhealth.net

Sunday, February 21, 2010

Hpv Symptoms – Exploding The Myths

Perhaps the most important point to note about HPV symptoms is that in many cases there are none!

Both men and women can carry one of the strains of HPV that results in genital warts, or worse still, cervical cancer, yet show no signs or symptoms whatsoever. Yet they can be pursuing an active sex life and unwittingly passing on the virus to one sexual partner after another.

In fact, the most prevalent strains of HPV that have been linked to cervical cancer are the least likely to show any symptoms for many years. Between 3000 and 4000 women die every year from cervical cancer, which is often treatable if caught in its early stages. Medical researchers believe that this number is so high because most women have no idea they have cervical cancer until it’s too late.

Remember that every time you have sex with a new partner, you are having sex with all the partners they had before you and all the partners those partners had…ad infinitum.

So before you swear off sex for the rest of your life, let’s look at some of the misunderstandings and myths surrounding HPV.

The Truth About HPV

* Around 250 individual strains of HPV have been identified, but only a few of them lead to the most problematic medical conditions – genital warts in both males and females and cervical cancer in females.
* Genital HPV is only transmitted by sexual contact, or in a very small number of cases, by oral sex with a partner who is already infected. You CAN’T catch HPV from a toilet seat or from sitting where someone else who has HPV has been sitting.
* If you discover you have genital warts, it doesn’t necessarily follow that your current sexual partner is the one who gave it to you. In most cases, the strains of HPV that cause genital warts can lie dormant in your system for many years before a breakout occurs.

A more realistic scenario is that you are the one who has unknowingly been passing on genital warts to your sexual partners while you’ve been blissfully unaware of its existence and at some future time they are going to blame their current partner for passing on the virus when, in fact, it was you.

* Contracting HPV does not mean you are promiscuous. You only need to have one sexual encounter to become infected with the virus. Obviously, the more you engage in frequent and unsafe sexual practices, the more likely you are to eventually come into contact with HPV or any one of a number of other sexually transmitted diseases.

So the logical solution is to always practice safe sex, particularly when you have a new sexual partner. Not only will a latex condom prevent you from the symptoms of HPV and other sexually transmitted diseases, it will help avoid unwanted pregnancy.

* Undergoing HPV treatment for genital warts is NOT a cure. Even if the warts have disappeared, you still carry the virus which means you can infect your sexual partner at any stage now or in the future.
* The HPV vaccine is believed to prevent all the recognized strains of HPV that can lead to cervical cancer in women. However, it doesn’t guarantee to prevent cervical cancer in girls or women who have been sexually active prior to being vaccinated.
* The jury is still out on whether uncircumcised men are more likely to carry the virus. While a number of studies have produced statistics which suggest the partners of uncircumcised men are at greater risk of contracting the strains of HPV which lead to cervical cancer, many medical researchers believe the statistics are flawed.

Every individual is at risk of being exposed to HPV and displaying HPV symptoms. The most effective ways to protect yourself are by practicing safe sex and by knowing and understanding as much as possible about HPV, HPV symptoms and HPV treatments.


Michelle Anderson - About the Author:
HPV Health is dedicated to bringing you the most current information on HPV.  We are dedicated to helping you.  For more information on symptoms and treatments visit HPV Treatment.

Saturday, February 20, 2010

Vaccines Are Not Hpv Cures


Most pharmacology efforts now focus on developing a vaccine to inoculate the population in order to stop the HPV virus from infecting the system. HPV vaccines protect against a very common sexually transmitted virus called HPV. HPV infects at least 50% of sexually active people at some point in their lives. The virus often clears on its own. If it persists, it can lead to cervical and other cancers and to genital warts.
Vaccination is ideal for the pharmaceutical companies as it would of course reap a monetary windfall of epic proportions for the drug companies. One HPV vaccine, Gardasil, was licensed for use by the FDA in 2006. In September 2008, the FDA announced it may also be used to prevent some cancers of the vulva and vagina when given to females aged 9-26. Another HPV vaccine, Cervarix, is also popular on the market.

Like all vaccines, these HPV vaccines are not foolproof. They do not protect against all of the 100-plus types of HPV. But both vaccines are nearly 100% effective in preventing disease caused by high-risk strains of HPV (HPV 16 and 18) which together account for 70% of all cervical cancers, as well as many cancers of the vagina and vulva.
Gardasil targets four types of HPV: 6, 11, 16 and 18. Types 16 and 18 lead to cervical cancer. HPV 6 and HPV 11 cause about 90% of genital warts. The vaccine contains a virus-like particle but not the actual virus. Three doses are given over six months to females aged 9-26. Scientists don't yet know if an HPV vaccine will protect boys from genital warts or if the vaccine can prevent boys from transmitting HPV to female partners.

The vaccine should be given to girls at ages 11 to 12, according to recommendations from the American Academy of Pediatrics and the CDC. The vaccine is best given at a young age, before sexual activity begins and before exposure to HPV.

The recommendations note that girls as young as 9 can get the vaccine, and females up to age 26 who didn't get it as youngsters. The vaccine is also being studied in older women.
Insurance coverage is common within the recommended age ranges. The federal Vaccines for Children Program covers the vaccine for those under age 19 who qualify. No serious HPV vaccine side effects have been found. Sometimes soreness occurs at the injection site. The jury is still out on whether the vaccine is effective in boys. More research needs to be done.

Another HPV vaccine, Cervarix, is also popular. In studies, this vaccine, like Gardasil, protected against types 16 and 18, which cause 70% of cervical cancers. Cervarix also protects against HPV types 31 and 45, which also cause cervical cancer, according to the manufacturer, GlaxoSmithKline. Three doses are given over six months.
Both HPV vaccines have been shown to provide protection. New research also suggests that Gardasil, like Cervarix, also protects against HPV types 45 and 31, which account for about 10% of cervical cancers. However, HPV vaccination doesn't mean women can skip their Pap tests. Neither vaccine protects against all the types of HPV that cause cervical cancer.

Importantly, China has now banned such vaccinations as they have found injecting a pathogen into your system does just that, it stays in your system, remaining latent in the joints, only to reappear in later years causing horrendous arthritis or auto immune disorders. What's more, the vaccines are not an HPV cure and not useful at all for those already affected with warts.

HPVCurative is a new, highly effective and potent way to cure genital warts. It is valued for its role in the realm of genital warts cures, and has provided total clearance of the infection time after time. It contains certified organic medicinal plant extracts and antiviral essential oils, which have demonstrated the ability to act as an HPV cure in laboratory tests.

HPVCurative is so effective among available HPV cures because it not only contains only the most potent certified organic antiviral medicinal plant extracts, but is highly tolerable to genital tissue as well. CURED use plant extracts for their genital warts cures that are produced in very limited quantities, and are not available in the commercial market due to scarcity.

These medicinal plant extracts are purchased directly by CURED from cultivators in Sri Lanka and Madagascar. Since the treatment can effectively remove genital warts and wart-like substances on the genitals, acid or surgical HPV cures may soon become a thing of the past. To learn more, please go to http://www.bcured.net.

bcured - About the Author:
staff of Nature Power Company, which is a network company dedicated to promoting customers\' websites and developing softwares. You can go to the following websites to learn more about our natural organic products. http://www.bcured.net  http://www.naturespharma.org


Friday, February 19, 2010

Hpv Men – The Proof You Need Protection


Genital human papilloma virus (or HPV) is the most common sexually transmitted infection. Statistics indicate that up to 90% of males and females come into contact with HPV at some point in their life if they have been sexually active. And in many of these cases, they unwittingly pass it on to their partner.

But the good news is that the vast majority of the 250 recognised strains of HPV cause no symptoms, signs or illness and our immune system works to destroy the infection with no side effects. However, medical researchers have isolated 15 strains of the virus that can lead to serious health risks.

When it comes to the consequences of HPV, men are relatively fortunate because the most serious strains of HPV can lead to cervical cancer and death in women. Every year around 3000 to 4000 women die from cervical cancer, and in 70% of these cases, the cancer is directly related to HPV.

What are the Dangers of HPV?

In the vast majority of cases, men can become infected with HPV and show no signs or symptoms. However, simply showing no symptoms of infection doesn’t mean that you aren’t carrying one of the strains of HPV that can lead to cervical cancer in a woman. You just don’t know it.

So it pays to have regular check-ups with your medical practitioner every time you begin a new relationship. This may sound over-the-top and unnecessary, but how would you feel if you learned that you inadvertently passed on one of the deadly strains of HPV to your partner that resulted in cervical cancer?

Fortunately, genital HPV won’t kill you if you are male, but it can be very embarrassing, painful and unsightly if you contract one of the strains of HPV that results in genital warts.

Remember, every time you have sex with a new partner, you are having sex with every partner she has ever had and every partner they have ever had… scary, huh?

What are the Symptoms of HPV?

If you have detected any abnormalities including scaly or itchy patches or growths in your genital area, you need to get checked out immediately. HPV testing for men is a relatively simple procedure.

Genital warts tend to appear in clusters, like miniature cauliflowers. They can be quite small in size or spread across a wide area from your genitals through to your anus. The area surrounding the warts is often painful and the warts are often itchy.

If you are diagnosed with genital warts, your physician can recommend topical HPV treatments that relieve the symptoms until the infection has passed.

How to Prevent HPV Infections

You may have the genital warts virus and simply not know it. Even if you’ve never had an outbreak of genital warts, but particularly if you have, the strain of HPV that results in genital warts or a number of other serious conditions, including cancer, may be dormant in your system.

So always practicing safe sex is mandatory if you want to protect yourself from HPV and also so you can prevent spreading the infection to your partner. The risk that you could unwittingly pass the strains of HPV that lead to cervical cancer in women cannot be stressed enough.

To avoid coming into contact with HPV, men need to wear a latex condom when having sex. Not only does a condom help protect you from unwanted pregnancy, it also prevents you from catching HPV, as well as preventing you from passing it on. And HPV is only one of a number of sexually transmitted diseases that can infect you. None of them are pretty and all of them will have a dramatic impact on the state of your sexual health with all your future partners, for as long as you continue to be sexually active – and for most of us that means the rest of our lives.
 
Michelle Anderson - About the Author:
HPV Health is dedicated to bringing you the most current information on HPV.  We are dedicated to helping you.  For more information on symptoms and treatments visit HPV.


Thursday, February 18, 2010

How is HPV Infection Diagnosed

Infection by HPV is very common. At least half of people who are sexually active will contract the HPV virus at some point in their lives. Yet many don't know it because they don't have any symptoms. Whether symptoms occur or not can depend on the type of HPV virus involved in the infection. There are more than 100 types of HPV.

Some types of HPV are associated with cervical and other cancers, and no warts occur, and no other symptoms may be noticed. Some HPV types also cause common warts that you can find on other areas of the body such as your hands or feet. Some HPV types are associated with genital warts, although the warts are not always visible.

Genital warts take on many different appearances. They can be raised, flat, pink, or flesh-colored. Sometimes there is a single wart; other times multiple warts appear. They can be on the anus, cervix, scrotum, groin, thigh, or penis. Genital warts can show up weeks or even months after sexual contact with a person infected with HPV virus.

Some types of genital HPV infection are associated with cancer. If infection occurs with one of these virus types, precancerous changes can occur in cells in the tissue without causing any symptoms. The longer the virus is in the body, the higher your risk of developing health problems such as cervical cancer or anal cancer.

The appearance of genital warts is one way HPV infection is diagnosed. A doctor simply does a visual inspection. The HPV types associated with warts, however, are not generally the types associated with cancer. Women infected with the type of HPV that can cause cancer may first be told their Pap test results are abnormal.

Pap tests are the main way doctors find cervical cancer or precancerous changes in the cervix. To find out for sure if the changes are related to HPV, a doctor may decide to perform a DNA test to detect the virus in women who have an abnormal Pap smear. This tells you and your doctor whether the HPV virus you have can cause cancer.

Only certain strains of HPV cause cancer. Indeed, HPV 16 and 18 account for 70% of all cervical cancers. This DNA test is often done on women who have mild Pap test abnormalities. It may also be done as part of a routine Pap test to women over age 30. In the HPV test, a doctor takes a swab of cells from the cervix, just as for the Pap test.

The cells are then analyzed in the laboratory. The test can identify 13 of the high-risk HPV types associated with cervical cancer. This test is rarely given routinely to women under 30 because so many younger women are exposed to HPV and their bodies typically clear the infection without treatment.

The DNA test could cause unnecessary worry and concern. Some experts also believe that in younger women the cervix is more susceptible to the HPV virus and that as women get older the cervix may become less susceptible. In men, as in women, genital warts reflect HPV infection. But no specific test for the strains of HPV that cause cancer is available at this time for men.

Combining the Pap test with the HPV test is appropriate for women aged 30 and over. This test helps women and their doctors learn if a woman is at high risk or low risk for developing cervical cancer. If the HPV test is positive, the doctor can then decide if more testing is needed. One test that may be ordered next is a colposcopy.

HPVCurative is a new, highly effective and potent way to cure genital warts. It is valued for its role in the realm of genital warts cures, and has provided total clearance of the infection time after time. It contains certified organic medicinal plant extracts and antiviral essential oils, which have demonstrated the ability to act as an HPV cure in laboratory tests.

Traditional theories postulated that once a person is infected, HPV remained in the body for a lifetime. However, new studies using sensitive DNA techniques have shown that an HPV cure is possible through immunological response. Studies demonstrate that HPVCurative extracts created "significant destruction of HPV cells as evidenced from DNA tests".

HPVCurative contains stringently certified organic antiviral plant extracts, which have the ability to destroy the genital wart virus. The extracts are harvested and distilled by hand for medicinal use -- they are pure and complete. This is essential when creating HPV cures. To learn more, please go to http://www.bcured.net. 


bcured - About the Author:
staff of Nature Power Company, which is a network company dedicated to promoting customers' websites and developing softwares. You can go to the following websites to learn more about our natural organic products. http://www.bcured.net  http://www.naturespharma.org

Wednesday, February 17, 2010

Production of Recombinant Proteins Gst L1, E6 and E7 Tag Hpv 16 to be Used in Luminex Assay for Antibody Detection Among Tunisian Female Population Wi


Production of recombinant proteins GST L1, E6 and E7 tag HPV 16 to be used in LUMINEX assay for antibody detection among Tunisian female population with cervical cancer and controls



Achour. M*a, Ben Younes. Ra, Kahla. Sa, Kochbati. Lb, Zeghal. Dc, Maalej. Mb, Zouari. Fc, Oueslati. Ra

a- Laboratory of Environmental Immuno-Microbiology and cancerogenesis (IMEC Unit) Faculty of Sciences Bizerta 7021 Zarzouna Tunisia.
b- Service of Radiotherapy Institute of Cancer Salah Azeiz Tunisia.
c- Service of Gynecology- obstetrics Center of Maternity and Neonatalogy Hospital La Rabta Tunisia.

*Corresponding author
Achour Mongia
E-mail: mahaachour2000@yahoo.fr
Tel: 216 72 591 845
Fax: 216 72 590 566

ABSTRACT:

Certain types of Human Papillomavirus (HPVs), mainly HPV types 16 and 18 have been recognised as major etiological factors for the development of cervical cancer. Antibodies against HPV antigens have been found to be associated with cervical cancer evolution. Different assays can be used for antibody detection but they have low levels of sensitivity and specificity. In the present work we are interested to prepare recombinant proteins to be used in LUMINEX technology in order to undergo serological study in Tunisian female population. So, HPV types 16 L1, E6 and E7 sequences fused to their 3’-end to a sequence encoding the terminal undecapeptide of the SV40 large T-antigen (tag) were isolated from plasmids and inserted into a pGEX vector for expression as GST fusion proteins in E.coli. Coding sequences for L1tag, E6tag and E7tag of HPV 16 respectively were mobilized by digestion with enzymes and ligated into digested plasmids downstream of the GST domain. An expression plasmid for GST tag was constructed by inserting a fragment coding for the tag epitope. Cells of E.coli BL 21 were transformed with the pGEX plasmids and grown in Luria Bertani medium containing the ampicillin. Recombinant proteins expression was induced by adding 0.25 mM isopropyl-?-D-thio-galactoside (IPTG) to the medium. The bacteria were harvested after induction and pelleted bacteria were resuspended in phosphate buffered saline (PBS) and lysed using a high- pressure homogenizer. Lysates were then cleared by centrifugation.
Proteins were verified by migration in sodium dodecyl sulphate (SDS) gel electrophoresis. Data showed that they were stable for detection and these lysates have been conserved at -20°C to be used in Luminex for detection of antibodies in female Tunisian population. This assay showed that the sero- positivity toward the different antigens differs upon the group studied and differences between cases and controls were significant (P<0.001). In addition, elevated percentage of positivity was found for E7 (61 %) versus 44 % and only 21 % for E6 and L1 antigens respectively and the intensity of the antibody response toward the late antigen L1 and the early antigens E6 and E7 were different.

Key-words: GST tag - E coli - HPV 16 – L1 - E6 - E7 – LUMINEX

INTRODUCTION:
On a global level, human papillomavirus (HPV) is estimated to cause almost half a million cases and more than 270,000 deaths from cervical cancer, corresponding to more than 2.5 million years of life lost (YLL) annually (Sue et al., 2007).
HPV type 16 (and to a lesser degree HPV type 18) is linked with more rare cancers, namely cancer of the vulva, vagina, penis, anus, oropharynx and larynx. Effective prophylactic vaccines have been developed (Dillner et al., 2007). Molecular epidemiological studies have demonstrated that specific subtypes of HPV are associated with cervical cancer (Castle and Giuliano, 2003; Dillner and Brown, 2004).
The HPV group of viruses today consists of more than 100 completely characterized types. Partial sequences of additional isolates indicate that at least another 100 HPVs exist. Of these, 15 genital HPVs are established as oncogenic in humans. HPV type 16 is by far the most important virus, accounting for more than 50% of all cervical cancers. HPV16 is even more dominating as an etiology of the noncervical HPV-associated cancers (Dillner, 2005). HPV serology is complex for several reasons. Different types of HPV can infect the epithelia of skin or mucosa and induce proliferative diseases. HPV antibodies are type specific. Those targeting the major viral capsid protein L1 are markers of infection, and those targeting the viral oncoproteins E6 and E7 are markers for HPV-associated cancer (Waterboer et al., 2005). Conventional serologic methods such as ELISA allow the analysis of sera for antibodies to only 1 antigen per well. Previous studies have determined antibodies against early antigens as E6 protein by ELISA methods that use small, linear epitopes of the proteins but sometimes they show low sensitivities and specificities. To improve the immunologic method, other approaches have been advanced like radioimmunoprecipitation assays (RIPAs) with whole native proteins and sandwich ELISAs with full-length (Meschede et al., 1998). Today, HPV serology is performed mostly in a limited number of laboratories, but it is likely to become widely used in clinical laboratories in the post-HPV vaccination sera. Previous studies showed that the LUMINEX method constitutes an attractive method for HPV serology in high-throughput laboratories (Waterboer et al., 2006).
In the present report, viral antigens were expressed with pGEX vectors in Escherichia coli as double fusion proteins with N-terminal GST and a C-terminal peptide (tag) consisting of the 11 C-terminal amino acids from the large T antigen of simian virus 40. The protein concentrations of the cleared lysates have been determined using the Bradford-reagent and the characterization of the full-length recombinant proteins was verified by coomassie-stained SDS-PAGE. Furthermore, the titration of antigen lysates was done using mouse anti-tag antibodies. These antigens were then used in LUMINEX assay for antibody detection in Tunisian female population.

MATERIALS AND METHODS:

HPV 16 L1

A modified pGEX vector was constructed for expression of GST fusion protein with an additional C-terminal fusion tag in E.coli. HPV 16 L1 coding sequence lacking the 10 N-terminal residues was amplified by polymerase chain reaction PCR with SmaI/SalI ends and inserted into pGEX4T3tag opened by EcoRI digestion.

PCR primers:

HPV 16 L1 forward 5’GCAGTCCCCGGGGTCTACTTGCCTCCTGTCC
HPV 16 L1 reverse 5’GCATGAGTCGACCAGCTTACGTTTTTTGCGTTTAGC

E.coli BL21 cells transformed with the pGEX plasmids were grown at room temperature in Luria Bertani medium containing 1mM ampicillin; At an OD600 of 0.3 recombinant protein expression was induced by adding 0.25 mM isopropyl-?-D-thio-galactoside (IPTG) to the medium. The bacteria were harvested by centrifugation 15 h after induction. Pelleted bacteria were resuspended in 40 mM Tris pH 8, 200 mM NaCl, 1 mM EDTA (ethylenediaminetetraaceticacid) and 2 mM DTT (dithiothreitol) supplemented with complete protease inhibitor cocktail and lysed using a high pressure homogenizer. ATP (adenosine triphosphate) and MgCl2 were added to final concentration of 2 mM and 5 mM respectively (Sehr et al., 2001).
HPV 16 E6 and E7

HPV type 16 E6 and 16 E7 coding sequence fused at its 3’-end in frame to a sequence encoding the terminal undecapeptide of the SV40 large T-antigen (tag) is isolated from bluescript plasmid and inserted into a pGEX vector for expression as GST fusion protein in E.coli. These coding sequences for E6tag and E7tag were mobilized by digestion and ligated into digested plasmid downstream of the GST domain.
Then, E.coli BL 21 cells transformed with the pGEX plasmids were grown and induction protein expression was induced as previously described for L1. The bacteria were harvested 6h after induction by centrifugation. Pelleted bacteria were resuspended in PBS containing 2 mM DTT, 1% Triton X-100, and complete protease inhibitor cocktail and lysed with the high-pressure homogenizer. Lysates were then cleared by centrifugation and stored in aliquots at -20°C (Sehr et al., 2002).

Titration of proteins

- To determine the concentrations of different lysates we used the Bradford-reagent method
as previously described. Optic density has been measured at 595 nm (Bradford, 1976).
- The separation of recombinant proteins has been done by migration on 12% polyacrylamid gel electrophoresis and bands were revealed by coomassie staining.
- Titration of antigens: Lysates corresponding to GST L1tag and GST E6tag and GST E7tag were diluted in 1/3 steps, we start with the final concentration of 2 µg/µl and the detection of antigens was allowed by mouse anti-tag antibodies diluted to 1/4000, the optic density was then determined at 450 nm.

LUMINEX

Hardware and software Measurements were performed on a Luminex 100 Total System comprising the Luminex 100 analyzer, Luminex XYP plate handler, Luminex SD sheath fluid delivery system, a Pentium 4 personal computer (Dell) running Windows 2000 (Microsoft Corp.), and Luminex IS 2.2 SP1software (Waterboer et al., 2005).
Multiplex serology has been described in detail by Waterboer et al., 2005. Briefly, the method employs beads derivatized with glutathione, thereby permitting bead-mediated in situ affinity purification of viral antigens bacterially expressed as GST fusion proteins.
Spectrally distinct bead sets carrying different viral antigens were individually washed and subsequently mixed. Each sample of unfiltered diluted serum in preincubation buffer and mixed beads was combined and incubated. Bound antibodies were detected with biotinylated anti-human secondary antibody (goat anti-human IgG) and fluorescent detection conjugate (streptavidin-Rphycoerythrin). With the Luminex analyzer, reporter fluorescence of the beads was determined and expressed as median fluorescence intensity (MFI).
Viral antigens were expressed with pGEX vectors in Escherichia coli as double fusion proteins with N-terminal GST and a C-terminal peptide (tag) consisting of the 11 C-terminal amino acids from the large T antigen of simian virus 40. The expression constructs for E6, E7, and L1 of HPV types 16 as GST fusion proteins have been described (Sehr et al., 2001, 2002).
Bacterial lysate was diluted to 1 g/L in casein buffer (1 g/L casein in PBS, pH 7.4). For each antigen, GC beads were loaded with GST fusion proteins directly in the lysate and incubated for 1 h at room temperature in the dark on a shaker. The beads were then washed 3 times with 1 mL of casein buffer. Human sera from a case-control study divided into 70 controls and 71 cervical cancer cases. Ethics committee approval and informed consent of study participants for HPV serology were obtained. Sera were preincubated at a 1:50 dilution on a shaker for 1 h at room temperature in a serum preincubation buffer based on casein buffer and additionally containing 2 g/L lysate from bacteria expressing GST alone to block antibodies directed against residual bacterial proteins and GST.

Multiplex assay:

Bead sets carrying different antigens were mixed and 50 µL each of preincubated diluted serum and mixed beads were combined in 96-well plates with filter bottoms and incubated on a shaker for 1 h at room temperature in the dark. The beads were washed 3 times in 100 µL of casein buffer on a vacuum manifold. Biotinylated secondary antibody [goat anti-human IgG diluted 1:1000 in casein buffer was added and incubated as before. After washing, detection conjugate (streptavidin-R-phycoerythrin) diluted 1:1000 in casein buffer was incubated with the beads for 30 min. The beads were washed again, and the wells were filled with casein buffer. Reporter fluorescence of the beads was determined with the LUMINEX analyzer and expressed as median fluorescence intensity (MFI). To calculate antigen-specific reactivity, the MFI of GST tag was subtracted from the antigen MFI. This multiplex HPV serology method used in situ affinity–purified viral antigens developed yet for a conventional GST capture ELISA as previously described (Sehr et al., 2001).

RESULTS:

Using the Bradford method, we have determined concentrations of the three protein lysates by the measurement of optic density at 595 nm. GST L1tag, GST E6tag and GST E7tag have the following concentrations: 16, 19 and 23.5 µg/µl respectively.





The lysates were from bacteria over expressing GST L1tag (lane 3), GST E6tag (lane 5), GST E7tag (lane 4), GST tag (lane 2). Proteins were separated by gel electrophoresis and stained with coomassie.
M. molecular weight marker with molecular mass in kDa indicated in the left (lane 1).
As shown in this figure, the different bands obtained corresponding to the different recombinant proteins showing different apparent molecular weights. GST L1tag showed by migration in gel electrophoresis an 82 kDa molecular weight, and approximately 40-45 kDa for HPV 16 E7 and E6 GST fusion proteins respectively. However, the GSTtag showed a band of about 31 kDa.
For the determination of limit of detection of these proteins, different dilutions have been effectuated. As shown in figure 2, and using lower concentrations, the best detection was obtained for GST alone, followed by E7 then E6 and L1 antigens.



Data showed elevated percentages of sero-positivities in cervical cancer cases compared to controls toward the three antigens L1, E6 and E7 analysed using the LUMINEX assay: 21%, 44% and 61% respectively and differences in results between cases and controls were significant (P<0.001).
In addition, the technology LUMINEX allowed us to determine the intensity of the antibody response by analysing the MFI values determined for the different groups of patients toward the three antigens tested. Data showed that among cervical cancer cases, the distribution of the MFI values was different and it depends on the antigen type and the higher intensity of fluorescence was noted for the early antigens E6 and E7 compared to the late antigen L1. In fact, these values did not exceed 5609 units for L1 while for E6 and E7, higher MFI values reaching 13317 and 13235 were noted for E6 and E7 antigens respectively.












DISCUSSION:


In the present work, we have produced three recombinant proteins for HPV 16 as GST L1tag, GST E6tag and GST E7tag in E.coli. After production, we have verified the size of these proteins by separation on gel electrophoresis and results obtained were in agreement with the literature (Sehr et al., 2001, 2002).
Previous studies showed that different systems can be used for the production of viral expression for the HPV 16 (Biemelt et al., 2003). In fact, Virus-like particles (VLP) have been expressed in various systems: mammalian cells, yeast, Baculovirus, Transgenic plants, Semliki Forest Virus, Salmonella as well as E.coli (Sasagawa et al., 1995; Hagensee et al., 1993; Lyengar et al., 1996; Kirnbauer et al., 1993; Neeper et al., 1996). Among these various systems which can be used, the literature has reported that yeast could produce large quantities of recombinant protein in its native conformation, and the potential of contamination by toxins or infectious viruses is minimal compared to bacterial or mammalian expression systems. Moreover, yeast is a suitable host for the production of heterologous eukaryotic proteins since it allows posttranslational processing of polypeptides, such as folding and phosphorylation. In fact, previous studies have expressed HPV 16 E7 proteins in Schizosaccharomyces pombe and they have used a protocol of purification (Braspenning et al., 1997).
Yeast such as Sz. pombe is a system that has several advantages (Yuko et al., 1999). In fact, it can be handled conveniently, low-cost synthetic medium is used, and several milligrams of recombinant proteins can be produced. Braspenning et al., 1997 have developed purification protocol to obtain human papillomavirus HPV type 16 E7 proteins expressed in the yeast Sz. pombe by chromatography. In previous works, authors have expressed recombinant E6tag and E7tag proteins for HPV 16 and HPV 18 in Sz. Pombe (Meschede et al., 1998). The purified recombinant proteins were separated in silver-stained sodium dodecyl sulphate polyacrylamide gels. Production of antigens in plants is known to be safe and potentially very cost-effective alternative to traditional expression systems. HPV 16 L1 major capsid proteinhave been expressed in Nicotiana tabacum cv. Xanthi plants in order to produce prophylactic vaccines. This system is not easy to practise frequently (Varsani et al., 2003).
Compared to others, the E/coli system used in our work, has the advantage of the ease of antigen production and purification and provides large amounts of proteins which can be used for a wide range of studies including antigen and vaccine production; molecular immunology and structural biochemical and cell biology studies. Although a wide variety of E.coli host strains can be used for cloning and expression with the pGEX vectors, some strains as E.coli strain BL 21 maximize expression of full-length fusion proteins. This strain is defective in Omp T and Lon protease production and is the only strain able to express the fusion protein in a soluble intact form. In addition, the Glutathione-S-Transferase (GST) Gene Fusion System provides an integrated system for the expression, purification and detection of glutathione-S-transferase fusion proteins using E.coli (Saluta and Bell, 1998).
More recently, researchers have reported the transient expression mediated by a potato virus X derived vector of the E7 protein targeted to the secretory system of Nicotiana benthamiana (Franconi et al., 2006).
In addition, production of recombinant proteins L1, E6 as well as E7 and their stability have been verified. Higher detection was obtained for GST and at the same concentration, the detection of E6 and E7 is higher than L1. The differences noted concerning the production as well as the capacity of detection with the mouse anti-tag antibodies of the different recombinant proteins GST L1tag, GST E6tag and GST E7tag may be explained by the fact that L1 protein has relatively high molecular weight that is why it needs more steps of purification for the liberation of the bacterial proteins that can grow with the recombinant proteins (Waterboer et al., 2005).
These protein antigens prepared with the concentrations of 16, 19 and 23.5 µg/µl for L1, E6 and E7 respectively have been used in LUMINEX assay for antibody detection in Tunisian female human sera. This multiplex system enables antibody analyses of large numbers of sera against the different antigens in parallel and has the potential to replace ELISA technology.
Consequently, this method allows the simultaneous analysis of large numbers of serum samples for antibodies against multiple viral antigens would be useful for sero-epidemiologic studies on prevalence and disease association of human papillomaviruses (HPVs).
The literature has reported that HPV antibodies are type specific. Those targeting the major viral capsid protein L1 are markers of infection and those targeting the viral oncoproteins E6 and E7 are markers for HPV-associated cancer (Dillner, 2005; Waterboer et al., 2005). Data reported in the present work showed that the intensity of the antibody response was important for the early antigens E6 and E7 compared to L1 antigen and this may be explained by differences in characteristics of these proteins. The antibody response to HPV is, in general, type specific, and HPV serology is an important technology for determining the spread of type-specific HPV infections in populations and monitoring of the effect of HPV vaccines in inducing protective antibodies. The literature have showed that the antibodies against the major HPV capsid protein, L1, are induced after infection and usually stay detectable for many years after clearance of the infection, since they belong to the class of antibodies that mark past exposure to an infection. The concentrations of these antibodies correlate well with protection, and it is for L1 antibodies that there is an urgent need for efficient, standardized HPV serologic methods for use in vaccination implementation/evaluation efforts and for epidemiologic monitoring of the type-specific spread of HPV infections (Dillner, 2005).
In the present work uses the Luminex improved the sensitivity of antibody response and can replace conventional serologic methods such as ELISA which allow the analysis of sera for antibodies to only 1 antigen per well. However, this method for multiplex HPV serologic analysis combines the fluorescent bead array with a generic method allowing in situ affinity purification of any glutathione S-transferase (GST) fusion protein developed for conventional ELISA.
High-density planar arrays allow the analysis of very large numbers of targets but are limited in the number of samples that can be analyzed in a reasonable time frame at acceptable costs.
As a conclusion, production of recombinant proteins in E.coli enabled us to obtain recombinant proteins of HPV types as well as many other proteins relatively easy and in large quantities. Increased sensitivity and low imprecision of the Luminex-based method and the possibility for easy combination of different antibody assays lead to renewed interest in the use of these antibodies in predictive oncology.
Furthermore, using the LUMINEX technology and in countries lacking a cervical screening programme as our country we are able to investigate the feasibility of the serology analysis for sero-epidemiologic study or for vaccination purpose in Tunisian female population by parallel testing for antibodies against three antigens (E6, E7, and L1 proteins of HPV 16 type).

Acknowledgements:

We would like to thank Dr. Pawlita M and Dr. Sehr P and Dr Waterboer.T from the DKFZ Heidelberg Germany) for providing me all the products and materials necessary to the LUMINEX application.

References:

Biemelt S, Sonnewald U, Galmbacher P, Willmitzer L, Muller M (2003). Production of Human Papillomavirus Type 16 Virus-Like Particles in Transgenic Plants. J. Virol. 77: 9211-9220.

Bradford MM (1976). A rapid and sensitive method for the quantitation of quantities of protein utilising the principle of protein-dye binding. Ana. Biochem. 72: 248-254.

Braspenning J, Manetti R, Zumbach K, Meschede W, Gissman L, Tommasino M (1997). A General Purification Protocol for E7 Proteins from “High-and Low-Risk” Human Papillomavirus Types Expressed in the Yeast Schizosaccharomyces pombe. Prot. Expr. Purif. 10: 192-201.

Castle PE, Giuliano AR (2003). Genital tract infections, cervical inflammation, and antioxidant nutrients – assessing their roles as human papillomavirus cofactors. J. Natl. Cancer. Inst. Monogr. 31: 29-34.

Dillner J, Brown DR (2004). Can genital-tract human Papillomavirus infection and cervical cancer be prevented with a vaccine? Expert. Rev. Mol. Med. 9: 1–21.

Dillner J (2005). Toward “Serolomics”: Papillomavirus Serology Is Taking a Technologic Lead in High- Throughput Multiplexed Antibody Analysis. Clinical. Chemistry. 51: 1768-1769.

Dillner J, Arbyn M, Dillner L (2007). Translational Mini-Review Series on Vaccines: Monitoring of human papillomavirus vaccination. Clin. Exp. Immunol. 148: 199-207.

Franconi R, Massa S, Illiano E, Mullar A, Cirilli A, Accardi L, Di Bonito P, Giorgi C, Venuti A (2006). Exploiting the plant secretory pathway to improve the anticancer activity of a plant derived HPV 16 E7 vaccine. Int. J. Immunopathol. Pharmacol.19: 187-197.

Hagensee M.E, Yaegashi N, Galloway Dan (1993). Self-assembly of human papillomavirus type 1 capsids by expression of the L1 protein alone or by co-expression of the L1 and L2 capsid proteins. J. Virol. 67: 315-322.

Iyengar S, Shah KV, Kotloff KL, Ghim SJ, Viscidi RP (1996). Self-assembly of in vitro-translated human papillomavirus type 16 L1 capsid protein into virus-like particles and antigenic reactivity of the protein. Clin. Diagn. Lab. Immunol. 3: 733-739.

Kirnbauer R, Taub J, Greenstone H, Roden R, Durst M et al, Lowy DR, Schiller JT (1993). Efficient self- assembly of human papillomavirus type 16 L1 and L1-L2 into virus-like particles. J. Virol, 67: 6929-6936.

Meschede W, Zumbach K, Braspenning J, Scheffner M, Bribiesca L-B, Luande J, Gissman L , Pawlita M (1998). Antibodies against early proteins of human papillomaviruses as diagnostic markers for invasive cervical cancer. J. Clin. Microbiol. 36:475–80.

Neeper M. P, Hofmann KJ, Jansen KU (1996). Expression of the major capsid protein of human papillomavirus type 11 in Saccharomyces cerevisiae. Gene.18: 1-6.

Saluta M, Bell PA (1998). Troubleshooting GST fusion protein expression in E.coli. Life Science News, Amersham. Biosciences: 1-3.

Sasagawa T, Pushko P, Steers G, Gschmeissner SE, Hajibagheri MA, Finch J, Crawford L, Tommasino M (1995). Synthesis and assembly of virus-like particles of human papillomaviruses type 6 and type 16 in fission yeast Schizosaccharomyces pombe. Virology. 206:126-135.

Sehr P, Zumbach K, Pawlita M (2001). A generic capture ELISA for recombinant proteins fused to glutathione S-transferase: Validation for HPV serology. J. Immunol. Methods. 253: 153-162.

Sehr P, Muller M, Hopfl R, Widschwendter A, Pawlita M (2002). HPV antibody detection by ELISA with capsid protein L1 fused to glutathione S-transferase. J. Virol. Methods. 106: 61-70.

Sue JG, Jane JK, Katie K, Jeremy DG, Joshua S, Meredith KH O’Shea, F. Xavier B, Silvia de Sanjos´e c, Eduardo LF (2007). Cost-effectiveness of HPV 16, 18 vaccination in Brazil. Vaccine. 25: 6257-6270.

Varsani A, Williamson A-L, Rose RC, Jaffer M, Ribicki EP (2003). Expression of Human papillomavirus type 16 major capsid protein in transgenic Nicotiana tabacum cv. Xanthi. Arch. Virol. 148: 1771-1786.

Waterboer T, Sehr P, Pawlita M (2006). Suppression of non-specific binding in serological Luminex assays. J. Immunol. Methods. 309: 200– 204.

Waterboer T, Sehr P, Michael KM, Franceschi S, Nieland JD, Joos TO, Templin MF, Pawlita M (2005). Multiplex human papillomavirus serology based on in situ–purified glutathione S-transferase fusion proteins. Clin. Chem. 51: 1845–53.

Yuko GH, Hiromichi K (1999). Expression system for foreign genes using the fission yeast Schizosaccharomyces pombe. Biotechnol. Appl. Biochem. 30: 235-244.

Achour - About the Author:
Corresponding author:

Achour Mongia


Followers